WebAnswer. If the sequence of coding strand in a transcription unit is written as follows : 5’– ATGCATGCATGCATGCATGCATGCATGC –3’ Write down the sequence of mRNA. 259 Views. Answer. If a double stranded DNA has 20 per cent of cytosine, calculate the percent of adenine in the DNA. 485 Views. WebNov 19, 2024 · class-12 molecular-basis-of-inheritance 0votes 1answer Assertion : Initiation step of protein synthesis in prokaryotes and eukaryotes has several differneces. Reason : They both form mRNA -tRNA complex wit askedAug 11, 2024in Biologyby Kumari Prachi(82.7kpoints) class-12 molecular-basis-of-inheritance
Length of mRNA/DNA that carries information for complete …
WebClass 12 >> Biology >> Molecular Basis of Inheritance >> The Search for Genetic Material >> What is cistron? Biology Questions Question What is cistron? Medium Solution … WebIt states that the blending of alleles at meiosis and their later recombination don't alter the frequencies of the alleles in future generations, if sure assumptions area unit met. expressed otherwise, if sure assumptions area unit met, evolution won't occur as a result of the cistron frequencies won't modification from generation to generation ... ios for vmware
MCQ Questions for Class 12 Biology Chapter 5 Principles of …
WebOct 25, 2024 · class-12 genetics-&-molecular-basis-of-inheritance-and-mutation 0votes 1answer Define a cistron. Giving examples differentiate between monocistronic and polycistronic unit. askedSep 2, 2024in Biologyby Aryangupta(92.0kpoints) class-12 molecular-basis-inheritance 0votes 1answer The terms cistron, recon and muton were … WebMar 22, 2024 · Hint: Cistron is the part of genetic material that helps in the coding of various proteins. It carries genetic information and plays an important role during the process of synthesis of chain or protein molecules. Complete answer: Cistron is also known as a gene. They carry genetic material and show their property during the cis-trans test. WebCistron is the segment of DNA having information for synthesis of a particular protein or RNA. The segment encodes for the synthesis of RNA or polypeptide of protein molecule. ... Trueman Solutions for Class 12 Biology II Chapter 6. 145 Qs > Related questions. A unit of functional segment of DNA which determine single polypeptide chain is known ... ios forensic tools comparison table