WebSep 15, 2007 · A primer (Fish-F1) encoding the conserved motif region ([YH]SA[EAG]AWE) of the aligned fish IFN protein sequences and the adaptor primer (Table I) were used to … WebOct 23, 2024 · The FishF1/FishR1primer pair (Ward et al. 2005) was used to target a 655-bp portion of the COIgene located between homologous nucleotide sites no. 5571 and no. 6225 of the mitochondrial DNA in H. leoparda(NC_028325; Shen et al. 2016) for amplification by polymerase chain reaction (PCR).

DNA barcoding Australia

WebA 680 bp fragment of the COI gene was amplified using universal primers Fish F1 and Fish R1 and PCR conditions as previously described by Hubert et al. [29]. PCR was performed with a Phusion1 High-Fidelity PCR Master Mix (ThermoFisher, 1040–2678) using the … WebL.A.B. Barcoding Notes Primers used most frequently by the Smithsonian Insitution's DNA barcoding group Complementary Primer Name Dir. Sequence Author Uses Primers LCO1490 forward GGTCAACAAATCATAAAGATATTGG Folmer et al. 1994 various HCO2198 reverse TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. 1994 various … paisley print round tablecloth

Genetic variation and taxonomy of Rasbora group (Cyprinidae) …

WebOct 1, 2024 · In this study, 179 fish samples were collected, including 25 kinds of economic fish, of which 16 species (28.49%, 51 samples of 179 fish samples) were labeled incorrectly, as shown in Table 2 and Fig. 1.It is identified that the samples labeled as cod were actually the low-cost fish species, such as striped catfish (Pangasianodon … WebNational Center for Biotechnology Information WebNov 11, 2024 · Primer pair Fish F1 (5-TCAACCAACCACAAAGACATTGGCAC-3′) and Fish R1 (5-TAGACTTCTGGGTGGCCAAAGAATCA-3′) ... 5 pmol of each primer, and 2 µl (25–50ng) of genomic DNA. Amplification condition was performed with the initial denaturation at 94 °C for 5 min followed by 35 cycles at 94 °C for 30 s, 50 °C for 30 s … sully county equalization office