site stats

Pearleygate 202

WebJul 12, 2024 · The pEarleyGate103 and the recombinant vector pEarleyGate103-SmSPL2 were transformed into onion epidermal cells, respectively, and the GFP signal was recorded, as we previously described [25]. ...... WebpEarleyGate-202 (Search Vector Database) Backbone size (bp) 11775 Modifications to backbone YFP-C was fused after the Gateway cassette Vector type Plant Expression ; …

pEarleyGate 202 Sequence and Map - SnapGene

WebOct 7, 2024 · Plant diseases cause devastating crop losses around the world and threaten the food supply of millions of people. Over time, plants have developed various mechanisms for fighting off infections caused by pests and other pathogens such as viruses and bacteria. When plants become infected they kick their immune system into action by … WebApr 27, 2024 · To generate 35S:FLAG-KAI2 transgenic plants, a full-size KAI2-coding cDNA was fused in-frame to the 3ʹ end of the FLAG-coding sequence in the pEarleyGate 202 vector, and the expression construct was transformed into Col-0 plants. exterior wood white paint https://sullivanbabin.com

Stock Detail

Web>pEarleyGate 202 (N-FLAG) complete sequence 11775 bp tggcaggatatattgtggtgtaaacaaattgacgcttagacaacttaata acacattgcggacgtttttaatgtactgaattaacgccgaattaattcga WebApr 30, 2004 · 202 Parkgate Dr was built in 1994 and last sold on April 30, 2004 for $277,000. What is the rental estimate for this home? We estimate that 202 Parkgate Dr … WebMar 1, 2016 · To construct vectors for co-IP analysis, CaCDPK15 or CaWRKY40 in the pDONR vector was directly introduced into the destination vectors p35S:HA (pEarleyGate 201) and p35S:Flag (pEarleyGate 202) to ... exteris bayer

SmbHLH37 functions antagonistically with SmMYC2 in …

Category:Neurosurgery Specialists Novant Health Brain & Spine …

Tags:Pearleygate 202

Pearleygate 202

Vector Detail - Arabidopsis

Webwas sequenced and inserted into the pEarleyGate 202 . 138 . vector (Earley . et al., 2006) by an LR reaction (Gateway®) to generate the . 139 . pEarleyGate 202‒ SmbHLH37. overexpression vector. Agrobacterium-mediated gene . 140 . transfer was performed based on protocols established in our laboratory (Yan and . 141 . Wang, 2007). 142 WebJan 1, 2004 · We amplified the sequence containing MCS from the pUC-SPYNE plasmid (Walter et al., 2004) and used it to replace the ccdB sequence between attR1 and attR2 sites in the pEarleyGate 201-nYFP and...

Pearleygate 202

Did you know?

WebFor BiFC analysis, the vectors pEarleyGate 201-YN and pEar-leyGate 202-YC were kindly supplied by Dr Yuhai Cui (Lu etal., 2010). We cloned the full-length open reading frame … Webproduces interfaith entertainment and media for a new age - revolutionary music, radio, and television that draws upon positive faith teachings to foster education, health, community …

WebPearly Gates Inc. WebName. pEarleyGate202. Type. plasmid. Tair Accession. Vector:1007964470. Description. pEarleyGate 202 allows for rapid recombinational cloning of cDNAs from Gateway entry …

WebJul 30, 2024 · To generate plasmids for transgenic plant production, we further introduced all CDS-containing vectors into the pEarleyGate 202 (N-terminal Flag tag), pEarleyGate 203 (N-terminal myc tag), and pEarleyGate 104 (N-terminal eYFP fusion; Earley et al., 2006) vectors using Gateway LR Clonase enzyme mix (Invitrogen) to create the plant binary ... WebJan 2, 2024 · The CDS of MtARF3, MtGAF1 and three MtDELLAs was cloned into the pEarleyGate 201-YN or pEarleyGate 202-YC vectors, and the mRFP-AHL22 plasmid was used as nuclear localization marker. Combinations of Agrobacterium GV3101 strains harboring these constructions were agroinfiltrated into the leaves of 4-week-old N. …

WebCreated Date: 7/9/2004 6:02:45 PM

WebSubsequently, SmMYB52 was further recombined into the pEarleyGate 202 via LR reaction to obtain the pEarleyGate 202-SmMYB52 overexpression vector. To silence the SmMYB52 in S. miltiorrhiza, an RNAi vector pSmMYB52-RNAi was synthesized as described previously . Briefly, we designed a pair of amiRNA primers, ... exterity boxWebpEarleyGate 202. Chloramphenicol 11776 pEarleyGate 203. Chloramphenicol 11783 ... pEarleyGate 304. Chloramphenicol 10379 pEcCas. Kanamycin 14605 pEcgRNA. Spectinomycin 3134 ... exterity artiosignWebpEarleyGate 202 vector Sequence Copy Sequence LOCUS Exported 11776 bp ds-DNA circular SYN 11-1-2016 DEFINITION Gateway (R)-compatible plant transformation vector with an N-terminal FLAG tag. ACCESSION . VERSION . exterior worlds landscaping \\u0026 designWebJan 1, 2010 · The coding sequence of PKL, PKL-N, and PKL-C were amplified and cloned into the BamHI sites of the modified pEarleyGate 201-nYFP and pEarleyGate 202-cYFP vector by ClonExpress Entry One Step ... exterity playerWebImage: Illustrated plasmid map in PNG format GenBank File: Plasmid sequence and annotations. Use text editor or plasmid mapping software to view sequence. SnapGene File: Plasmid sequence and SnapGene enhanced annotations. Use with SnapGene software or the free Viewer to visualize additional data and align other sequences. exterior wrought iron railing for stairsWebNov 22, 2024 · The ENTRY vector pDONR207- SmbHLH37 was sequenced and inserted into the pEarleyGate 202 vector ( Earley et al., 2006) by an LR reaction (Gateway ®) to generate the pEarleyGate 202- SmbHLH37 overexpression vector. Agrobacterium -mediated gene transfer was performed based on protocols established in our laboratory ( Yan and Wang, … exterior wood treatment productsWebpEarleyGate vectors that we designed for transient or stable expression of proteins fused to a variety of oligopeptide epitope tags and/or GFP, YFP or CFP. Representative … exterior wood window trim repair